MUMmer 3 manual logo


Table of Contents

  1. Introduction
    1. Description
    2. Comparative genomics
      1. Available sequence
      2. Human vs. Human
    3. OSI open source
  2. Installation
    1. System requirements
    2. Obtaining MUMmer
    3. Compilation and installation
  3. Running MUMmer
  4. Use cases and walk-throughs
    1. Aligning two finished sequences
      1. Highly similar sequences without rearrangements
      2. Highly similar sequences with rearrangements
      3. Fairly similar sequences
      4. Fairly dissimilar sequences
    2. Aligning two draft sequences
    3. Mapping a draft sequence to a finished sequence
    4. SNP detection
    5. Identifying repeats
  5. Program descriptions
    1. Maximal exact matching
      1. mummer
      2. repeat-match
      3. exact-tandems
    2. Clustering
      1. gaps
      2. mgaps
    3. Alignment generators
      1. NUCmer
      2. PROmer
      3. run-mummer1
      4. run-mummer3
    4. Utilities
      1. delta-filter
      2. mapview
      3. mummerplot
      4. show-aligns
      5. show-coords
      6. show-snps
      7. show-tiling
  6. Known problems
  7. Acknowledgements
  8. Contact information

1. Introduction

MUMmer is an open source software package for the rapid alignment of very large DNA and amino acid sequences. The latest version, release 3.0, includes a new suffix tree algorithm that has further improved the efficiency of the package and has been integral to making MUMmer an open source product. If you are familiar with the previous versions of MUMmer, you will find the new version is very similar because most of the changes have been to the implementation and not the interface, however this document assumes no previous experience with MUMmer, so past users may find it desirable to skip or skim through some of the sections.

1.1. Description

MUMmer is a modular and versatile package that relies on a suffix tree data structure for efficient pattern matching. Suffix trees are suited for large data sets because they can be constructed and searched in linear time and space. This allows mummer to find all 20 base pair maximal exact matches between two ~5 million base pair bacterial genomes in 20 seconds, using 90 MB of RAM, on a typical 1.7 GHz Linux desktop computer. Using a seed and extend strategy, other parts of the MUMmer pipeline use these exact matches as alignment anchors to generate pair-wise alignments similar to BLAST output. Also included are some utilities to handle the alignment output and a primitive plotting tool (mummerplot) that allows the user to convert MUMmer output to gnuplot files for dot and percent identity plots. Another graphical utility called MapView is included with the MUMmer distribution and displays sequence alignments to a annotated reference sequence for exon refinement and investigation.

This modular design has an important side effect, it allows for the easy reuse of MUMmer modules in other software. For instance, one can imagine primer design, repeat masking and even comparative annotation tools based on the efficient matching algorithm MUMmer provides. Another advantage of MUMmer is its speed. Its low runtime and memory requirements allow it to be used on most any computer. MUMmer's efficiency also makes it ideal for aligning huge sequences such as completed and draft eukarotic genomes. MUMmer has been successfully used to align the mouse and human genomes, showing it can handle most any input available. In addition, its ability to handle multiple sequences facilitate many vs. many searches, and make the comparison of unfinished draft sequence quite simple. However, because of it's many abilities, inexperienced users may find it difficult to determine the best methods for their application, so please refer to the Running MUMmer and Use cases sections for brief descriptions, use case examples, and tips on making the most of the MUMmer package, or if you want to understand more about a specific utility, refer to Program descriptions section for more detailed information and output formats.

1.2. Comparative genomics

1.2.1. Available sequence

The MUMmer package provides efficient means for comparing an entire genome against another. However, until 1999 there were no two genomes of sufficient similarity to compare. With the publication of the second strain of Helicobacter pylori in 1999, following the publication of the first strain in 1997, the scientific world had its first chance to look at two complete bacterial genomes whose DNA sequences were highly similar. The number of pairs of closely-related genomes has exploded in recent years, facilitating many comparative studies. For instance, the published databases include the following genomes for which multiple strains and/or multiple species have been sequenced:

multiple strains of...
  • Agrobacterium tumefaciens
  • Bacillus anthracis
  • Brucella melitensis
  • Buchnera aphidicola
  • Chlamydophila pneumoniae
  • Escherichia coli
  • Helicobacter pylori
  • Mycobacterium tuberculosis
  • Neisseria meningitidis
  • Staphylococcus aureus
  • Streptococcus pyogenes
  • Streptococcus pneumoniae
  • Yersinia pestis
multiple species of...
  • Bacillus
  • Chlamydia
  • Clostridium
  • Corynebacterium
  • Lactobacillus
  • Listeria
  • Methanosarcina
  • Mycobacterium
  • Mycoplasma
  • Plasmodium
  • Pseudomonas
  • Pyrococcus
  • Rickettsia
  • Saccharomyces
  • Staphylococcus
  • Streptococcus
  • Thermoplasma
  • Vibrio
  • Xanthomonas
  • Xylella

Most of these genomes can be obtained from the NCBI ftp site: ftp://ftp.ncbi.nlm.nih.gov/genomes/

1.2.2. Human vs. Human

With the capability to align the entire human genome to itself, there is no genome too large for MUMmer. The following table gives run times and space requirements for a cross comparison of all human chromosomes. The 1st column indicates the chromosome number, with "Un" referring to unmapped contigs. Column 2 shows chromosome length and column 4 shows the length of the total genomic DNA searched against the chromosome in column 1. Column 3 shows the time to construct the suffix tree, and column 5 the time to stream the query sequence through it. Column 6 shows the maximum amount of computer memory occupied by the program and data, and column 7 shows memory usage for the suffix tree in bytes per base pair. Each human chromosome was used as a reference, and the rest of the genome was used as a query and streamed against it. To avoid duplication, we only included chromosomes in the query if they had not already been compared; thus we first used chromosome 1 as a reference, and streamed the other 23 chromosomes against it. Then we used chromosome 2 as a reference, and streamed chromosomes 3–22, X, and Y against that, and so on.

Chr Ref length
(Mbp)
Suffix time
(min)
Qry length
(Mbp)
Query time
(min)
Total space
(Mb)
Suffix space
(bytes/bp)
1 221.8 24.6 2617.1 679.5 3702 15.43
2 237.6 27.4 2379.5 625.8 3908 15.43
3 194.8 21.2 2184.7 565.0 3232 15.43
4 188.4 22.4 1996.3 518.0 3121 15.43
5 177.7 18.6 1818.6 461.4 2952 15.43
6 175.8 17.9 1642.8 407.6 2900 15.43
7 153.8 15.7 1489.0 360.1 2550 15.43
8 142.8 14.4 1346.2 322.3 2378 15.43
9 117.0 10.7 1229.2 303.7 1974 15.43
10 131.1 13.2 1098.1 263.3 2195 15.43
11 133.2 13.1 964.9 225.6 2228 15.43
12 129.4 12.5 835.5 195.9 2168 15.43
13 95.2 8.6 740.3 163.6 1633 15.44
14 88.2 7.5 652.1 141.0 1523 15.44
15 83.6 6.8 568.5 122.1 1451 15.44
16 80.9 6.4 487.6 106.3 1409 15.44
17 80.7 6.6 406.9 91.8 1406 15.44
18 74.6 6.3 332.3 78.8 1311 15.44
19 56.4 3.7 275.8 56.1 1026 15.45
20 59.4 4.6 216.4 45.8 1073 15.45
21 33.9 2.1 182.5 33.7 673 15.48
22 33.8 2.0 148.6 26.4 672 15.48
Un 1.4 0.03 147.3 10.0 164 16.96
X 147.3 14.6   4.8 2327 15.57

The Human Chromosomes can be obtained from the NCBI ftp site: ftp://ftp.ncbi.nih.gov/genomes/H_sapiens/

1.3. OSI open source

The key difference between version 3.0 and previous versions of MUMmer, is its qualification as an open source project. Previous versions of MUMmer were always free for non-profit, but now MUMmer is free for all organizations, both for- and non-profit. Please refer to the LICENSE file included in the package for a description of the Artistic License, the same OSI certified open source license used by Perl and countless other packages. We encourage you to contact us (though you are not required to) if you wish to contribute to our ongoing improvement and development of the software, and simple suggestions on how to improve MUMmer are always welcome. Enjoy the freedom of open source!

To receive software update notices, please join the MUMmer mailing list. This list will only be used to announce major version releases and help us keep track of MUMmer users.

OSI logo

2. Installation

MUMmer comes as a source distribution only, and needs to be compiled before use. This sections describes the steps and requirements necessary to compile the package. Installation problems are usually caused by incompatible versions of one or more OS utilities, so if installation fails please check that you have the needed system requirements before alerting us of your problem. The INSTALL file included in the source distribution also contains much of the same information provided in this section.

2.1. System Requirements

MUMmer is mostly written in C and C++. With some technical expertise it could be ported to any system with a C++ compiler, but our distribution was specifically designed to be compiled with the GNU GCC compiler and has been successfully tested on the following three platforms:

MUMmer also requires some third party software to run successfully. In the absence of one or more of the below utilities, certain MUMmer programs may fail to run correctly. Listed in parenthesis are the versions used to test the MUMmer package. These versions, or subsequent versions should assure the proper execution of the various MUMmer programs. These utilities must be accessible via the system path:

For running the MUMmer display programs, these additional system utilities are required:

Sufficient memory and disk space are also necessary, but required sizes vary considerably with input size, so please be aware of your disk and memory usage, as insufficient capacities will result in incorrect or missing output. In general, 512 MB of RAM and 1 GB of disk space is sufficient for most mid-sized comparisons. For Mac OSX, the Mac development kit must be downloaded and installed. This kit will include gcc, ar, and make which are necessary for building MUMmer. MUMmer is not supported for any Mac operating system other than OSX.

2.2. Obtaining MUMmer

The current MUMmer release can be downloaded from our SourceForge.net project page.

2.3. Compilation and installation

For explanation purposes, let's suppose you just downloaded the MUMmer3.0.tar.gz distribution from the SourceForge site. The first step would be to move this file to the desired installation directory and type:

tar -xvzf MUMmer3.0.tar.gz

to extract the MUMmer source into a MUMmer3.0 subdirectory. Switch to this newly created subdirectory and execute:

make check

to assure the makefile can identify the necessary utilities. If no error messages appear, the diagnostics were successful and you may continue. However, if error messages are displayed, the listed programs are not accessible via your system path. Install the utilities if necessary, add them to your system PATH variable, and continue with the MUMmer installation by typing:

make install

This will attempt to compile the MUMmer scripts and executables. If the make command issues no errors, the compilation was successful and you are ready to begin using MUMmer. If the command fails, it is likely that make was confused by the existence of more than one copy of the same utility, such as two versions of gcc. When this happens, it is important to arrange you system PATH variable so that the more recent versions are listed first, or to hard code the location of your utility location in the makefile. The same advice goes for your LD_LIBRARY_PATH variable if your system is having a difficult time locating the appropriate C or C++ libraries at runtime.

It is important to note that the make command dynamically builds the MUMmer scripts to reference the install directory, therefore if the install directory is moved after the make command is issued the MUMmer scripts will fail. If you need certain MUMmer executables in a directory other than the install directory, it is recommend to leave the install directory untouched and link the needed executables to the desired destination. An alternative would be to move the install directory and reissue the make command at the new location.


3. Running MUMmer

The five most commonly used programs in the MUMmer package are mummer, nucmer, promer, run-mummer1 and run-mummer3, so this section covers the basics of executing these tools and what each of them specializes in. To better understand how to view the outputs of these programs, please refer to the use cases section or the MUMmer examples webpage for a brief walk-through of each major module with full input data and expected outputs. For further information, please refer to the Program descriptions section for a detailed explanation of each program and its output.

mummer

mummer efficiently locates maximal unique matches between two sequences using a suffix tree data structure. This makes mummer most suited for generating lists of exact matches that can be displayed as a dot plot, or used as anchors in generating pair-wise alignments.

mummer [options] <reference file> <query file1> . . . [query file32]

There must be exactly one reference file and at least one query file. Both the reference and query files should be in multi-FastA format and may contain any set of upper and lowercase characters, thus DNA and protein sequences are both allowed and matching is case insensitive. The maximum number of query files is 32, but there is no limit on how many sequences each reference or query file may contain. Output is to stdout. Refer to the mummer section for a list of options and output descriptions.

NUCmer

NUCmer is a Perl script pipeline for the alignment of multiple closely related nucleotide sequences. It begins by finding maximal exact matches of a given length, it then clusters these matches to form larger inexact alignment regions, and finally, it extends alignments outward from each of the matches to join the clusters into a single high scoring pair-wise alignment. This makes NUCmer most suited for locating and displaying highly conserved regions of DNA sequence. To increase NUCmer's accuracy, it may be desirable to mask the input sequences to avoid the alignment of uninteresting sequence, or to change the uniqueness constraints (see the NUCmer section) to reduce the number of repeat induced alignments.

nucmer [options] <reference file> <query file>

Both the reference and query files should be in multi-FastA format and may contain any set of upper and lowercase characters, however only the DNA characters a, c, t and g will be aligned (case insensitive). There is no limit on how many sequences the reference or query files may contain. Output is written to the file out.delta This is an ASCII file, but not formatted for human consumption, so it is necessary to run a utility program to parse the output. The two primary utility programs for viewing the contents of a .delta file are show-aligns, and show-coords. show-aligns displays all of the pair-wise alignments between two sequences, while show-coords displays a summary of the coordinates, percent identity, etc. of the alignment regions. Refer to the NUCmer section for a list of options and output descriptions.

PROmer

PROmer is a Perl script pipeline for the alignment of multiple somewhat divergent nucleotide sequences. It works exactly like NUCmer, but with a small twist. Before any of the exact matching takes place, the input sequences are translated in all six amino acid reading frames. This allows PROmer to identify regions of conserved protein sequences that may not be conserved on the DNA level and thus gives it a higher sensitivity than NUCmer. Note however, this increase in sensitivity will result in huge amounts of output for highly similar sequences, therefore it is recommended that PROmer only be used when the input sequences are too divergent to produce a reasonable amount of NUCmer output. As with NUCmer, it is recommended to mask the input sequences to avoid the alignment of uninteresting sequence, or to change the uniqueness constraints (see the PROmer section) to reduce the number of repeat induced alignments.

promer [options] <reference file> <query file>

Both the reference and query files should be in multi-FastA format and may contain any set of upper and lowercase characters, however only valid DNA characters will result in correctly translated sequence, all other characters will be translated into masking characters and therefore will not be matched by the BLOSUM scoring matrix. There is no limit on how many sequences the reference or query files may contain. Output is written to the same files as NUCmer and can also be viewed with the same utility programs (see above). Refer to the PROmer section for a list of options and output descriptions.

run-mummer1 and run-mummer3

run-mummer1 and run-mummer3 are shell script pipelines for the general alignment of two sequences. They follow the same three steps of NUCmer and PROmer, in that they match, cluster and extend, however they handle any input sequence, not just nucleotide. This non-discrimination can be useful, however the program interface is not very user friendly and the output can be difficult to parse. In their favor, the run-mummer* programs are good at aligning very similar DNA sequences and identifying their differences, this makes them well suited for SNP and error detection. run-mummer1 is recommended for one vs. one comparisons with no rearrangements, while run-mummer3 is recommended for one vs. many comparisons that may involved rearrangements. Sequence masking is only recommended if a different character is used to mask the reference and query sequences so that they are not aligned.

run-mummer1 <reference file> <query file> <prefix> [-r]

or

run-mummer3 <reference file> <query file> <prefix>

The reference and query files should both be in FastA format and may contain any set of upper and lowercase characters. The reference file may only contain a single sequence, and run-mummer1 only allows a single query sequence, but run-mummer3 has no limit on the number of query sequences . The -r option for run-mummer1 reverses the query sequence, while run-mummer3 automatically finds both forward and reverse matches. Output is written to the files <prefix>.out, <prefix>.gaps, <prefix>.errorsgaps and <prefix>.align. There are no utilities included to parse these files, so they must be viewed as raw text files. Refer to the run-mummer1 and run-mummer3 sections for info on changing the program parameters and output descriptions.


4. Use cases and walk-throughs

Because of its breadth, MUMmer can be overwhelming at first, and sometimes the hardest part of using MUMmer is deciding which alignment program to run for a particular application. This section attempts to overview some of the basic MUMmer use cases and propose the best MUMmer alignment routine for each case. This section only gives a set of command line calls to generate alignments for each use case. For further information, please refer to the Program descriptions section for a detailed explanation of each program and its output, and the MUMmer examples webpage for a brief walk-through of each major module with full input data and expected outputs.

4.1. Aligning two finished sequences

The most basic use case is the alignment of two contiguous sequences. For all of the one vs. one use cases the mummer program alone, when coupled with mummerplot, may be all that is necessary to visualize a global alignment of the two sequences. This process alone can be very helpful in determining the large scale differences between the two sequences. For a single reference sequence ref.fasta and a single query sequence qry.fasta in FastA format, type:

mummer -mum -b -c ref.fasta qry.fasta > ref_qry.mums

mummerplot --postscript --prefix=ref_qry ref_qry.mums

gnuplot ref_qry.gp

Then view or print the postscript plot ref_qry.ps in whatever manner you wish.

4.1.1. Highly similar sequences without rearrangements

When comparing two near identical sequences, the object of the alignment is usually SNP and small indel identification. The original MUMmer1.0 pipeline still proves to be a handy tool for this type of analysis, although run-mummer3 with combineMUMs -D can prove to be even handier. Its LIS clustering algorithm and reliance on unique matches give it some reliability advantages over the newer pipelines. For a single reference sequence ref.fasta and a single query sequence qry.fasta in FastA format, type:

run-mummer1 ref.fasta qry.fasta ref_qry

or for sequences that match on the reverse strand

run-mummer1 ref.fasta qry.fasta ref_qry -r

SNP detection and one-to-one global alignment can also be performed by nucmer as described in the SNP detection walkthrough. The NUCmer pipeline provides a more user-friendly method for SNP detection while sacrificing a small degree of sensitivity.

4.1.2. Highly similar sequences with rearrangements

Often two sequences are highly similar, but large chunks of the sequence are rearranged, inverted and inserted. In order to align these and produce an output that is similar to the MUMmer1.0 pipeline, use run-mummer3. It uses a clustering method that allows for these types of large scale mutations, but retains many of the other features of run-mummer1. To hunt for SNPs more accurately, you can edit the script and add the -D option to the combineMUMs command line, thus producing a concise file of only the difference positions between the two sequences. For a single reference sequence ref.fasta and a single query sequence qry.fasta in FastA format, type:

run-mummer3 ref.fasta qry.fasta ref_qry

SNP detection and one-to-one local alignment can also be performed by nucmer as described in the SNP detection walkthrough. The NUCmer pipeline provides a more user-friendly method for SNP detection while sacrificing a small degree of sensitivity.

4.1.3. Fairly similar sequences

While run-mummer1 and run-mummer3 focus more on what is different between two sequences, nucmer focuses on what is the same. It has very few restrictions on what it will align, so rearrangements, inversions and repeats will all be identified by nucmer. For a single reference sequence ref.fasta and a single query sequence qry.fasta in FastA format, type:

nucmer --maxgap=500 --mincluster=100 --prefix=ref_qry ref.fasta qry.fasta

show-coords -r ref_qry.delta > ref_qry.coords

show-aligns ref_qry.delta refname qryname > ref_qry.aligns

Where refname and qryname are the FastA IDs of the two sequences. The output of NUCmer can often be voluminous and is best visualized with mummerplot. In addition, its output can be filtered in a varity of ways with the delta-filter program. For example, to select and display a one-to-one local mapping of reference to query sequences, use:

delta-filter -q -r ref_qry.delta > ref_qry.filter

mummerplot ref_qry.filter -R ref.fasta -Q qry.fasta

This will first filter the delta file, selecting only those alignments which comprise the one-to-one mapping between reference and query, and then display a dotplot of the selected alignments. Note that NUCmer allows for multiple reference and query sequences, so the above methods will also work for such and input. See the delta-filter and mummerplot sections for more details.

4.1.4. Fairly dissimilar sequences

Sometimes two sequences exhibit poor similarity on the DNA level, but their protein sequences are conserved. In this case, promer will be the most useful MUMmer tool, since it translates the DNA input sequences into amino acids before proceeding with the alignment. For a single DNA reference sequence ref.fasta and a single DNA query sequence qry.fasta in FastA format, type:

promer --prefix=ref_qry ref.fasta qry.fasta

show-coords -r ref_qry.delta > ref_qry.coords

show-aligns -r ref_qry.delta refname qryname > ref_qry.aligns

Where refname and qryname are the FastA IDs of the two sequences. Note that the -k option can be added to show-coords to reduce the amount of output by only displaying the best frame in situations where the same hit is represented in multiple, overlapping frames. The output of PROmer can often be voluminous and is best visualized with mummerplot. In addition, its output can be filtered in a varity of ways with the delta-filter program. For example, to select and display a one-to-one local mapping of reference to query sequences, use:

delta-filter -q -r ref_qry.delta > ref_qry.filter

mummerplot ref_qry.filter -R ref.fasta -Q qry.fasta

This will first filter the delta file, selecting only those alignments which comprise the one-to-one mapping between reference and query, and then display a dotplot of the selected alignments. Note that PROmer allows for multiple reference and query sequences, so the above methods will also work for such an input. See the delta-filter and mummerplot sections for more details.

4.2. Aligning two draft sequences

Many times it is necessary to align two genomes that have not yet been completed, or two genomes with multiple chromosomes. This can make things a little more complicated, since a separate alignment would have to be generated for each possible pairing of the sequences. However, both NUCmer and PROmer automate this process and accept multi-FastA inputs, thus simplifying the process of aligning two sets of contigs, scaffolds or chromosomes. Since NUCmer and PROmer have an almost identical user interface, this use case will only be explained using nucmer. If the two inputs are too divergent for nucmer to align, simply use promer instead. For two sets of contigs, ref.fasta and qry.fasta, type:

nucmer --prefix=ref_qry ref.fasta qry.fasta

show-coords -rcl ref_qry.delta > ref_qry.coords

show-aligns ref_qry.delta refname qryname > ref_qry.aligns

Where refname and qryname are the FastA IDs of two contigs. The show-aligns step will have to be repeated for every combination of contigs that the user wishes to analyze. Because the output of the all-vs-all comparison described above can be immense, it is often essential to filter the resulting alignment data with the delta-filter program. To map each reference to a position in the query, use delta-filter -r. To map each query to a position in the reference, use delta-filter -q. To determine a one-to-one mapping of each reference and query, combine the options and use delta-filter -r -q. Also, the mummerplot utility provides a very handy visualization method for viewing contig mappings, type:

mummerplot ref_qry.delta -R ref.fasta -Q qry.fasta --filter --layout

This will generate a plot displaying the one-to-one mapping between the two contig sets. When plotted to an X11 terminal, the plot is zoom-able and browse-able via the mouse and keyboard commands provided by gnuplot 4.0. See the delta-filter and mummerplot sections for more details.

4.3. Mapping a draft sequence to a finished sequence

There are many benefits of mapping a draft sequence to the finished sequence of a related organism. Determining the location and orientation of each query contig as it maps to the finished reference sequence can significantly speed up the closure process of the draft sequence, and by examining the areas of conservation, the annotation of the draft sequence can be improved and refined. Since NUCmer and PROmer have an almost identical user interface, this use case will only be explained using nucmer. If the two inputs are to divergent for nucmer, simply use promer instead. For a finished reference chromosome(s) ref.fasta and a set of near identical contigs qry.fasta, type:

nucmer --prefix=ref_qry ref.fasta qry.fasta

show-coords -rcl ref_qry.delta > ref_qry.coords

show-aligns ref_qry.delta refname qryname > ref_qry.aligns

show-tiling ref_qry.delta > ref_qry.tiling

Where refname and qryname are the FastA IDs of two sequences. The show-aligns step will have to be repeated for every combination of sequences that the user wishes to analyze. If mapping the draft sequences to each of their repeat locations is not required, the delta-filter program can quickly select the optimal placement of each draft sequence to the reference using the following:

delta-filter -q ref_qry.delta > ref_qry.filter

The newly created delta file ref_qry.filter can then be substituted for the original in the above procedures in order to generate slimmed down versions of the output.

4.4. SNP detection

Joining a couple of the MUMmer components together can form a quite reliable SNP detection pipeline. MUMmer can perform all steps of this pipeline from aligning the sequences, to selecting the one-to-one mapping, and finally calling the SNP positions. The user can then process these SNP positions to assign quality scores based on the underlying traces and surrounding context. Such methods have been successfully applied to various SNP studies for organisms including Bacillus anthracis and Yersinia pestis. Of important note, a SNP pipeline built with nucmer allows for the identification of SNPs between two genomes with many rearrangements. The Yersinia pestis strains, for example, demonstrate significant genome "shuffling", and make SNP detection difficult with global alignment programs such as run-mummer1. However, a pipeline built with nucmer (like shown below) is capable of finding all of the SNPs between two genomes, regardless of their structural similarity.

To find a reliable set of SNPs between to highly similar multi-FastA sequence sets ref.fasta and qry.fasta, type:

nucmer --prefix=ref_qry ref.fasta qry.fasta

show-snps -Clr ref_qry.delta > ref_qry.snps

The -C option in show-snps assures that only SNPs found in uniquely aligned sequence will be reported, thus excluding SNPs contained in repeats. An alternative method which first attempts to determine the "correct" repeat copy is:

nucmer --prefix=ref_qry ref.fasta qry.fasta

delta-filter -r -q ref_qry.delta > ref_qry.filter

show-snps -Clr ref_qry.filter > ref_qry.snps

Now, conflicting repeat copies will first be eliminated with delta-filter and the SNPs will be re-called in hopes of finding some that were previously masked by another repeat copy.

4.5. Identifying repeats

Although MUMmer was not specifically designed to identify repeats, it does has a few methods of identifying exact and exact tandem repeats. In addition to these methods, the nucmer alignment script can be used to align a sequence (or set of sequences) to itself. By ignoring all of the hits that have the same coordinates in both inputs, one can generate a list of inexact repeats. When using this method of repeat detection, be sure to set the --maxmatch and --nosimplify options to ensure the correct results.

To find large inexact repeats in a set of sequences seq.fasta, type the following and ignore all hits with the same start coordinate in each copy of the sequence:

nucmer --maxmatch --nosimplify --prefix=seq_seq seq.fasta seq.fasta

show-coords -r seq_seq.delta > seq_seq.coords

To find exact repeats of length 50 or greater in a single sequence seq.fasta, type:

repeat-match -n 50 seq.fasta > seq.repeats

To find exact tandem repeats of length 50 or greater in a single sequence seq.fasta, type:

exact-tandems seq.fasta 50 > seq.tandems


5. Program descriptions

The most commonly used MUMmer pipelines (nucmer, promer, run-mummer1 and run-mummer3) are comprised of three main sections. The first section identifies a certain subset of maximal exact matches between the two inputs, the second section clusters these matches into groups that will likely make good alignment anchors, and the third and final section extends alignments between these clustered matches to produce the final gapped alignment. These three sections also outline the primary types of programs included in the MUMmer package - the Maximal exact matching section describes the programs that compute different types maximal exact matches, the Clustering section describes the two different types of clustering algorithms, and Alignment generators describes the scripts that combine matching, clustering and extending in order to produce high scoring pair-wise alignments. Finally, the Utilities section reviews a few of the tools that have been developed for interpreting and displaying the output of the MUMmer alignment routines.

It is noteworthy to point out the simplicity of improving the current MUMmer pipeline. For instance, if a different and/or better clustering algorithm was needed for a certain application, a program could be written in any language and inserted into the pipeline. So long as the program was able to read the appropriate input and produce output that mimics the existing module, it could be swapped for the existing module with a single edit to the calling script. NUCmer for example is a Perl script that invokes various MUMmer routines. If you were to develop a new clustering algorithm called mygaps you could edit the line in NUCmer that defines the location of mgaps to instead define the location of mygaps. It's that easy, as long as mygaps had the same input and output mgaps the transition would be seamless.

5.1. Maximal exact matching

The heart of the MUMmer package is its suffix tree based maximal matching routines. These can be used for repeat detection within a single sequence as is done by repeat-match and exact-tandems, or can be used for the alignment of two or more sequences as is done by mummer. Most every other program in the MUMmer packages builds off of the output of the mummer maximal exact matcher, so it is of great importance to first understand the workings of this program.

5.1.1. mummer

mummer is a suffix tree algorithm designed to find maximal exact matches of some minimum length between two input sequences. MUMmer's namesake program originally stood for Maximal Unique Matcher, however in subsequent versions the meaning of unique has been skewed. The original version (1.0) required all maximal matches to be unique in both the reference and the query sequence (MUMs); the second version (2.0) required uniqueness only in the reference sequence (MUM-candidates); and the current version (3.0) can ignore uniqueness completely, however it defaults to finding MUM-candidates and can be switched on the command line. To restate, by default mummer will only find maximal matches that are unique in the entire set of reference sequences. The match lists produced by mummer can be used alone to generate alignment dot plots, or can be passed on to the clustering algorithms for the identification of longer non-exact regions of conservation. These match lists have great versatility because they contain huge amounts of information and can be passed forward to other interpretation programs for clustering, analysis, searching, etc.

mummer achieves its high performance by using a very efficient data structure known as a suffix tree. This data structure can be both constructed and searched in linear time, making it ideal for large scale pattern matching. To save memory, only the reference sequence(s) is used to construct the suffix tree and the query sequences are then streamed through the data structure while all of the maximal exact matches are extracted and displayed to the user. Because only the reference sequence is loaded into memory, the space requirement for any particular mummer run is only dependent on the size of the reference sequence. Therefore, if you have a reasonably sized sequence set that you want to match against an enormous set of sequences, it is wise to make the smaller file the reference to assure the process will not exhaust your computer's memory resources. The query files are loaded into memory one at a time, so for an enormous query that will require a significant amount of memory just to load the character string, it is helpful to partition the query into multiple smaller files using the syntax described below.

Command line syntax

mummer [options] <reference file> <query file1> . . . [query file32]

There must be exactly one reference file and at least one query file. Both the reference and query files should be in multi-FastA format and may contain any set of upper and lowercase characters, thus DNA and protein sequences are both allowed and matching is case insensitive. The maximum number of query files is 32, but there is no limit on how many sequences each reference or query file may contain.

Program options
-mum Compute MUMs, i.e. matches that are unique in both the reference and query
-mumreference Compute MUM-candidates, i.e. matches that are unique in the reference but not necessarily in the query
-maxmatch Compute all maximal matches regardless of their uniqueness
-n Only match the characters a, c, g, or t (case insensitive)
-l int Minimum match length (default 20)
-b Compute both forward and reverse complement matches
-r Only compute reverse complement matches
-s Show the matching substring in the output
-c Report the query position of a reverse complement match relative to the forward strand of the query sequence
-F Force 4 column output format that prepends every match line with the reference sequence identifier
-L Show the length of the query sequence on the header line
-help Show the possible options and exit

Option grouping is not allowed, therefore each option should be separated by a space. The options -mum, -mumreference, and -maxmatch cannot be combined, and if neither is used, then the program will default to -mumreference. For a string to be unique in the reference, it must occur only once in the concatenation of all the reference superstrings, but for string to be unique in the query it need only be unique in its own superstring. Setting either the -mum or -mumreference option can significantly cut down on the number of repeat induced matches as opposed to -maxmatch, and is recommended for most all applications. Also, setting the -l option any lower than around 15 can significantly increase the number of spurious matches and therefore balloon the runtime. When dealing with masked DNA sequence, use the -n option to avoid matching the masking characters. Options -b and -r exclude each other, and if neither is used then only forward matches will be reported. All reverse complementing will affect only the query sequences. Option -c can only be used in combination with -b or -r, as it would have no relevance without these options. The -F option is useful for forcing mummer to output a consistent format regardless of the number of input sequences.

For those familiar with the previous versions of MUMmer, the -mum option mimics the functionality of MUMmer1.0; the -mumreference option mimics the functionality of MUMmer2.0; and the -maxmatch option mimics the functionality of the max-match program included with MUMmer2.0. The default behavior of the current version is -mumreference because it is a good balance between finding all matches and only unique matches.

Output format

Output formatting varies depending on the command line parameters used. Program diagnostic information is always output to stderr while the match lists are output to stdout. This allows for the match output to be redirected into a file, which is quite useful since the output is generally quite large. The standard output format that results from running mummer on a single reference sequence with the -b option is as follows:


> ID1
 4655667         1        31
 4655699        33       319
 4656019       353       520
 4656540       874        20
> ID1 Reverse
  741743        22       872
> ID2
 4655520         1       498
 4656019       500       274
 4656317       798        39
 4656376       855        29
> ID2 Reverse
> ID3
> ID3 Reverse
 4655178        27       840
 4656019       868       171
(output continues ...)

For each query sequence, the corresponding ID tag is reported on each line beginning with a '>' symbol, even if there are no matches corresponding to this sequence. Reverse complemented matches follow a query header that has the keyword Reverse following the sequence tag, thus creating two headers for each query sequence and alternating forward and reverse match lists. For each match, the three columns list the position in the reference sequence, the position in the query sequence, and the length of the match respectively. Reverse complemented query positions are reported relative to the reverse of the query sequence unless the -c option was used. As was stated above the -L option adds the sequence lengths to the header line and the -s option adds the match strings to the output, if these options were used the format would be as follows:


> ID1  Len = 893
 4655667         1        31
ctgacgacaaccatgcaccacctgtcactct
 4655699        33       319
ctcccgaaggagaagccctatctctagggttgtcagaggatgtcaagacctgg . . .
 4656019       353       520
gttcctccatatctctacgcatttcaccgctacacatggaattccactttcct . . .
 4656540       874        20
tttcgaaccatgcggttcaa
> ID1 Reverse  Len = 893
  741743        22       872
tgaaaggcggcttcggctgtcacttatggatggacccgcgtcgcattagctag . . .
> ID2  Len = 884
 4655520         1       498
tcataaggggcatgatgatttgacgtcatccccaccttcctccggtttgtcac . . .
 4656019       500       274
gttcctccatatctctacgcatttcaccgctacacatggaattccactttcct . . .
 4656317       798        39
aagccttcatcactcacgcggcgttgctccgtcagactt
 4656376       855        29
cctactgctgcctcccgtaggagtctggg
> ID2 Reverse  Len = 884
> ID3  Len = 1039
> ID3 Reverse  Len = 1039
 4655178        27       840
atcaattctccatagaaaggaggtgatccagccgcaccttccgatacggctac . . .
 4656019       868       171
gttcctccatatctctacgcatttcaccgctacacatggaattccactttcct . . .
(output continues ...)

Where the length of each query is noted after the Len keyword and the match string is listed on the line after its match coordinates. Note that the ellipsis marks are not part of the actual output, but added to fit the output into the webpage. Finally, when dealing with multiple reference sequences (or the -F option), it is necessary to output the ID of the reference sequence. This is placed at the beginning of each match line, creating an four column output format as follows:


> ID1
  220594       479         1       728
> ID1 Reverse
  220716      3527         1        20
  220716      3548        22       840
> ID2
> ID2 Reverse
  219093        13       401       484
  220716      3682         2        29
  220716      3731        49        39
  220716      3794       112       693
> ID3
  219093        13       188       721
  220716      3897         2       590
  220716      4488       593       423
> ID3 Reverse
  220594         1        38       509
(output continues ...)

5.1.2. repeat-match

repeat-match is a suffix tree algorithm designed to find maximal exact repeats within a single input sequence. It uses a similar algorithm to mummer, but altered slightly to find maximal exact matches within a single sequence.

Command line syntax

repeat-match [options] <sequence file>

The sequence file should contain only one sequence in FastA format, however if multiple sequences exist the first one will be used. The sequence may contain any set of upper and lowercase characters, thus DNA and protein sequences are both allowed and matching is case insensitive.

Program options
-f Use the forward strand only
-n int Minimum match length (default 20)
-t Only output tandem repeats

The program will report both forward and reverse complement repeats by default unless the -f option is used. While the -t option identifies tandem repeats, the exact-tandems script is a wrapper for repeat-match and does a more graceful job of reporting the tandem repeats.

Output format

Output formatting varies depending on the command line parameters. Program diagnostic information is always output to stderr while the match lists are output to stdout. This allows for the match output to be redirected into a file, which is quite useful since the output can be quite large. The standard output format that results from running repeat-match with default parameters is as follows:


Long Exact Matches:
   Start1     Start2    Length
  4919485    4919506r       22
  4997298    4997319r       22
  4919485    4997298        22
  3461866    3751066        53
   537897    4650529r       76
(output continues ...)

The three columns are the first position of the repeat, the second position of the repeat, and the length of the repeat respectively. Reverse complement repeat positions are denoted by an 'r' following the Start2 position, and are relative to the forward strand of the sequence.

5.1.3. exact-tandems

exact-tandems is a wrapper shell script for the repeat-match program. It provides a list of exact tandem repeats within a single input sequence.

Command line syntax

exact-tandems <sequence file> <min length>

As with repeat-match the sequence file should contain only one sequence in FastA format, however if multiple sequences exist the first one will be used. The sequence may contain any set of upper and lowercase characters, thus DNA and protein sequence are both allowed and matching is case insensitive. The minimum match length parameter should be a positive integer, this value will be passed to the repeat-match program via the -n option.

Output format

Program diagnostic information is always output to stderr while the match lists are output to stdout. This allows for the match output to be redirected into a file, which is quite useful since the output can be quite large. The output format of exact-tandems is as follows:


Finding matches
Tandem repeats
   Start   Extent  UnitLen     Copies
  416173      150       45        3.3
  554810      102       42        2.4
  554943      109       42        2.6
  880346      191       63        3.0
  880370       62       21        3.0
(output continues ...)

The four columns are the first position of the tandem, the extent of the repeat region, the length of each tandem repeat unit, and the number of repeat units respectively.

5.2. Clustering

MUMmer's clustering algorithms attempt to order small individual matches into larger match clusters in order to make the output of mummer more intelligible. A dot plot makes it easy to spot alignment regions from a match list, however when examining the data without graphic aids, it is very difficult to draw any reasonable conclusions from the simple flat file list of matches. Clustering the matches together into larger groups of neighboring matches makes this process much easier by ordering the data and removing spurious matches.

5.2.1. gaps

gaps is the primary clustering algorithm for run-mummer1, and although classified as a "clustering" step, gaps is more of a sorting routine. It implements the LIS (longest increasing subset) algorithm to extract the longest consistent set of matches between two sequences, and generates a single cluster that represents the best "straight-line" arrangement of matches between the sequences. By straight-line, we mean no rearrangements or inversions, just a simple path of agreeing matches between the two sequences. This limits the usability of this program to the alignment of genomes that are very similar and with no large scale mutations. To further illustrate the purpose of this program, consider the following set of MUMs (illustrated as line connecting two rectangles) between two sequences:

gaps example

The rectangles connected by lines are maximal exact matches between two sequences, however only the red rectangles would be included in the LIS because they form the longest increasing subset of matches, i.e. the longest subset of matches that are consistently ordered in both genomes. Note that the empty rectangles will be discarded, even though they probably represent a major rearrangement between the two sequences. Because of this limitation gaps is best suited for the comparison of near identical sequences with the goal of finding minor mutations like SNPs and small indels.

Command line syntax

mummer [params] | tail +2 | gaps <reference file> [-r]

or

gaps <reference file> [-r] < <match list>

Because gaps receives its input from stdin, the input can either be piped directly from filtered mummer output, or redirected as input from a file. The strange syntax is a result of a legacy issue described in the Known problems section, and requires the header be stripped from the mummer output. In addition, gaps is only designed to handle a single reference and a single query sequence, thus the preceding mummer run must also follow this constraint. The -r is optional and designates the incoming matches as reverse complement matches which must reference the reverse complement of the sequence, therefore forcing mummer to be run without the -c option. Please refer to the run-mummer1 script for an example of how to use this program in an alignment pipeline. A rewrite of this algorithm to handle multiple reference and/or query sequences may eventually appear, but is not currently in development.

Output format

The stdout output of gaps shares much in common with the standard three column match output, with the addition of three extra columns:


> /home/aphillip/data/GHP.1con  Consistent matches
     183       17     22    none      -      -
     238       72    108    none     33     33
     347      181     92    none      1      1
     458      292     50    none     19     19
     705      539     44    none      1      1
     750      584     38    none      1      1
     807      641     23     -16      0      4
(output continues ...)
> Wrap around
  334398   329917     47    none      -    225
  334446   329965     62    none      1      1
  334539   330058     20    none     31     31
  334560   330079     92    none      1      1
  334653   330172     77    none      1      1
  334740   330259     41    none     10     10
(output continues ...)
> /home/aphillip/data/GHP.1con  Other matches
 1317231     4891     21    none      -      -
 1317275     4927     21    none      -      -
 1317804     5399     25    none    508    451
  947580     5436     36    none      -      -
   23406     5518     34    none      -      -
  333079     6592     32    none      -      -
(output continues ...)

Where the first line is the location of the reference file, and the first three columns are the same as the three column match format described in the mummer section. The final three columns are the overlap between this match and the previous match, the gap between the start of this match and the end of the previous match in the reference, and the gap between the start of this match and the end of the previous match in the query respectively. A couple suggestions on how to visually scan through this output: a gap size == 1 means a single mismatch between the two sequences, e.g. a SNP, an overlap like seen in the last line of the Consistent matches indicates the existence of a tandem repeat, and a '-' character means that the gap size could not be calculated. The Wrap around list is for circular genomes where the consistent set of matches wraps around the origin of the reference, and the Other matches list shows the matches that were not included in the LIS (like the white boxes in the above image). Finally, if the -r was passed on the command line the Consistent matches and Other matches headers would contain the reverse keyword after the reference file.

5.2.2. mgaps

mgaps was introduced into the MUMmer pipeline in an effort to better handle large-scale rearrangements and duplications. Unlike gaps, mgaps is a full clustering algorithm that is capable of generating multiple groups of consistently ordered matches. Clustering is controlled by a set of command-line parameters that adjust the minimum cluster size, maximum gap between matches, etc. Only matches that were included in clusters will appear in the output, so by adjusting the command-line parameters it is possible to filter out many of the spurious matches, thus leaving only the larger areas of conservation between the input sequences. The major advantage of mgaps is its ability to identify these "islands" of conservation. This frees the user from the single LIS restraints of the gaps program and allows for the identification of large-scale rearrangements, duplications, gene families and so on. To further illustrate the purpose of this program, consider once again the following set of MUMs (illustrated as line connecting two rectangles) between two sequences:

mgaps example

Just like before the rectangles connected by lines are maximal exact matches between two sequences, with each distinct cluster having its own unique color. In the previous demonstration using this MUM set, gaps failed to identify the blue cluster because it was not consistent with the LIS. However, by using mgaps, all regions of conservation have now been identified. The only fallback being the increased complexity of the output, where you once had only one cluster for the whole comparison, you now have four. Because of this, it can sometimes be difficult separating the repetitive clusters from "correct" clusters, making mgaps more suited for global alignments instead of localized error detection.

Command line syntax

mummer [params] | mgaps [options]

or

mgaps < <match list>

Because gaps receives its input from stdin, the input can either be piped directly from raw mummer output, or redirected as input from a mummer output file. mgaps is only designed to handle a single reference and one or more query sequences, thus the preceding mummer run must also follow this constraint. Please refer to the run-mummer3 script for an example of how to use this program in an alignment pipeline. Note that in order to cluster reverse complement matches, the reverse complement matches must reference the reverse complement strand of the query sequence, therefore forcing mummer to be run without the -c option. A rewrite of this algorithm to handle multiple reference sequences and a better coordinate system (forward coordinates for reverse complement matches) is doubtful but may eventually appear.

Program options
-C Check that input header labels alternately have the "Reverse" keyword
-d int Maximum fixed diagonal difference (default 5)
-e Use extent of cluster (end - start) rather than the sum of the match lengths to determine cluster length
-f float Maximum fraction of separation for diagonal difference (default 0.05)
-l int Minimum cluster length (default 200)
-s int Maximum separation between adjacent matches in a cluster (default 1000)

The -d option can be interpreted as the number of insertions allowed between two matches in the same cluster, while the -f option is a fraction equal to (diagonal difference / match separation) where a higher value will increase the indel tolerance. Minimum cluster length is the sum of the contained matches unless the -e option is used. The best way to get a feel for what each parameter controls is to cluster the same data set numerous times with different values and observe the resulting differences. It can also be helpful to set these parameters to the size of the element you wish to capture, i.e. set the minimum cluster size to say the smallest exon you expect and set the max gap to the smallest intron you expect to obtain clusters that could represent single exons (depending of course of the similarity of the two sequences).

Output format

The stdout output of mgaps shares much in common with the output of mummer and gaps, with a slightly different header formatting than gaps to allow for multiple query sequences and multiple clusters. The output of mgaps run on both forward and reverse complement matches is as follows:


> ID41
> ID41 Reverse
 5177399        1    232    none      -      -
 5177632      234   6794    none      1      1
 5184433     7035     24    none      7      7
 5184468     7069     23    none     11     10
> ID42
   10181       43   1521    none      -      -
> ID42 Reverse
 4654536       17     36    none      -      -
 4654578       57    298    none      6      4
 4654877      356    226    none      1      1
#
 4655139      845     28    none      -      -
 4655178      884    694    none     11     11
 4655873     1579     20    none      1      1
#
 4850044       17   1492    none      -      -
 4851537     1510    711    none      1      1
 4852249     2222     42    none      1      1
(output continues ...)
Headers containing the ID for each query sequence are listed after the '>' characters, and a following Reverse keyword identifies the reverse matches for that query sequence. Individual clusters for each sequence are separated by a '#' character, and the six columns are exactly the same as the gaps output (see the gaps section for more details).

5.3. Alignment generators

The alignment scripts described in this section build upon the data generated by the previous two sections, maximal exact matching and clustering. Each of these scripts independently runs the matching and clustering steps, and then generates pair-wise alignments for each of the clusters. This translates to a basic seed and extend method of alignment. The individual matches within each cluster are used as alignment anchors and only the mismatching sequence between the matches is processed by the Smith-Waterman dynamic programming routine. This reduces both the time and memory necessary to align large sequences, while still producing accurate alignments.

5.3.1. NUCmer

NUCmer (NUCleotide MUMmer) is the most user-friendly alignment script for standard DNA sequence alignment. It is a robust pipeline that allows for multiple reference and multiple query sequences to be aligned in a many vs. many fashion. For instance, a very common use for nucmer is to determine the position and orientation of a set of sequence contigs in relation to a finished sequence, however it can be just as effective in comparing two finished sequences to one another. Like all of the other alignment scripts, it is a three step process - maximal exact matching, match clustering, and alignment extension. It begins by using mummer to find all of the maximal unique matches of a given length between the two input sequences. Following the matching phase, individual matches are clustered into closely grouped sets with mgaps. Finally, the non-exact sequence between matches is aligned via a modified Smith-Waterman algorithm, and the clusters themselves are extended outwards in order to increase the overall coverage of the alignments. nucmer uses the mgaps clustering routine which allows for rearrangements, duplications and inversions; as a consequence, nucmer is best suited for large-scale global alignments, as is shown in the following plot:

nucmer dot plot

This dot plot represents a nucmer alignment of two different strains of Helicobacter pylori (26695 on the x-axis and J99 on the y-axis). Forward matches are shown in red, while reverse matches are shown in green. This alignment, which took only 12 seconds to compute, clearly shows a major inversion event centered around the origin of replication, and demonstrates NUCmer's ability to handle large scale rearrangements between sequences of high nucleotide similarity.

Command line syntax

nucmer [options] <reference file> <query file>

The reference and query files should both be in multi-FastA format and have no limit on the number of sequences they man contain. However, because nucmer uses mummer for its maximal exact matching, the memory usage will be dependent on the size of the reference file, so it may be advisable to make the smaller of the input files the reference to assure the program does not exhaust your computer's memory resources. In addition, masking the uninteresting regions of the input with any character other than a, c, g, or t will both speed up nucmer by reducing the number of possible matches and also cut down on the number of alignments induced by repetitive sequence.

Program options
--mum Use anchor matches that are unique in both the reference and query
--mumreference Use anchor matches that are unique in the reference but not necessarily unique in the query (default behavior)
--maxmatch Use all anchor matches regardless of their uniqueness
-b int
--breaklen
Distance an alignment extension will attempt to extend poor scoring regions before giving up (default 200)
-c int
--mincluster
Minimum cluster length (default 65)
--[no]delta Toggle the creation of the delta file. Setting --nodelta prevents the alignment extension step and only outputs the match clusters (default --delta)
--depend Print the dependency information and exit
-d float
--diagfactor
Maximum diagonal difference factor for clustering, i.e. diagonal difference / match separation (default 0.12)
--[no]extend Toggle the outward extension of alignments from their anchoring clusters. Setting --noextend will prevent alignment extensions but still align the DNA between clustered matches and create the .delta file (default --extend)
-f
--forward
Align only the forward strands of each sequence
-g int
--maxgap
Maximum gap between two adjacent matches in a cluster (default 90)
-h
--help
Print the help information and exit
-l int
--minmatch
Minimum length of an maximal exact match (default 20)
-o
--coords
Automatically generate the <prefix>.coords file using the 'show-coords' program with the -r option
--[no]optimize Toggle alignment score optimization. Setting --nooptimize will prevent alignment score optimization and result in sometimes longer, but lower scoring alignments (default --optimize)
-p string
--prefix
Set the output file prefix (default out)
-r
--reverse
Align only the reverse strand of the query sequence to the forward strand of the reference
--[no]simplify Simplify alignments by removing shadowed clusters. Turn this option off if aligning a sequence to itself to look for repeats (default --simplify)
-V
--version
Print the version information and exit

All values are measured in DNA bases unless otherwise noted. Using either the -mum or -mumreference options (along with masking the input sequences) can help reduce the number of repeat induced alignments, and is suggested for most applications. If no uniqueness options are set, the program will default to -mumreference. Decreasing the values of the -mincluster and --minmatch options will increase the sensitivity of the alignment but may produce less reliable alignments. In addition, significantly raising the value of the --maxgap value (say to 1000) can be crucial in producing alignments for more divergent genomes. Setting --noextend speeds up the process by preventing alignment extensions outward from each cluster, while --nodelta takes this a step further and doesn't even align the sequence between the matches in a cluster, however both of these reduce the amount of information contained in the output. See mgaps description for hints on setting the clustering parameters --mincluster, --diagdiff and --maxgap. The --coords option exists only for NUCmer1.0 compatibility; instead, it is recommended to run show-coords afterwards with more specific options. The --nooptimize option will force alignments within --breaklen bases of the sequence end to extend all the way to the sequence end, regardless of the resulting alignment score. The --prefix string should be unique in the output directory to prevent overwriting pre-existing data. Finally, by default nucmer matches the forward and reverse strands of the query sequences to the forward strand of the reference sequence unless the --forward or --reverse options were used, and all output coordinates always reference the forward strand of their respective sequence. Only use the --nosimplify option when aligning a sequence to itself in order to find inexact repeats.

Output format

Because nucmer and promer produce the same output files, this section will serve to explain the <prefix>.delta format for both programs. The delta file contains an encoded representation of all the alignments generated in the "extend" phase of the pipeline, and is a unique format for concise, machine representation of the pair-wise alignments. Several tools described in the Utilities section were designed to interpret these files and extract useful, human-readable information from them, however the full format description the delta file is described below to aid developers.

The "delta" file format

The "delta" file is an encoded representation of the all-vs-all alignment between the input sequences to either the NUCmer or PROmer pipeline. It is the primary output of these alignment scripts and there are various utilities described in section 5.4. that are designed to take the delta file as input, and output some human-readable information to the user. Also, the delta-filter utility is designed to manipulate these files and select desired alignments. The primary function of the delta file is to catalog the coordinates of each alignment and note the distance between insertions and deletions contained in these alignments. By only storing the location of each indel as an offset, disk space is efficiently utilized, and a potentially enormous alignment can be stored in a relatively small space. The first line lists the two original input files separated by a space, while the second line specifies the alignment data type, either "NUCMER" or "PROMER". Every grouping of alignments have a unique header specifying the two aligning sequences. Only sequences with shared alignments will have a header; therefore, there can be no empty headers (i.e. those that have no alignments following them). An example header might look like


>tagA1 tagB1 500 20000000
Following this sequence header is the alignment data. Each alignment following also has a header that describes the coordinates of the alignment and some error information. These coordinates are inclusive and reference the forward strand of the DNA sequence, regardless of the alignment type (DNA or amino acid). Thus, if the start coordinate is greater than the end coordinate, the alignment is on the reverse strand. The four coordinates are the start and end in the reference and the start and end in the query respectively. The three digits following the location coordinates are the number of errors (non-identities + indels), similarity errors (non-positive match scores), and stop codons (does not apply to DNA alignments, will be "0"). An example header might look like:

2631 3401 2464 3234 15 15 2

Notice that the start coordinate points to the first base in the first codon, and the end coordinate points to the last base in the last codon. Therefore making (end - start + 1) % 3 = 0. This makes determining the frame of the amino acid alignment a simple matter of determining the reading frame of the start coordinate for the reference and query. Obviously, these calculations are not necessary when dealing with vanilla DNA alignments.

Each of these alignment headers is followed by a string of signed digits, one per line, with the final line before the next header equaling 0 (zero). Each digit represents the distance to the next insertion in the reference (positive int) or deletion in the reference (negative int), as measured in DNA bases OR amino acids depending on the alignment data type. For example, with the PROMER data type, the delta sequence (1, -3, 4, 0) would represent an insertion at positions 1 and 7 in the translated reference sequence and an insertion at position 3 in the translated query sequence. Or with letters:


A = ABCDACBDCAC$
B = BCCDACDCAC$
Delta = (1, -3, 4, 0)
A = ABC.DACBDCAC$
B = .BCCDAC.DCAC$

Using this delta information, it is possible to re-generate the alignments calculated by nucmer or promer as is done in the show-coords program. This allows various utilities to be crafted to process and analyze the alignment data using a universal format. This also means the delta only needs to be created once, yet it can be analyzed numerous times without ever having to rerun the costly alignment algorithm. Below is an example of what a delta file might look like:


/home/username/reference.fasta /home/username/query.fasta
PROMER
>tagA1 tagB1 3000000 2000000
1667803 1667078 1641506 1640769 14 7 2
-145
-3
-1
-40
0
1667804 1667079 1641507 1640770 10 5 3
-146
-1
-1
-34
0
>tagA2 tagB4 4000 3000
2631 3401 2464 3234 4 0 0
0
2608 3402 2456 3235 10 5 0
7
1
1
1
1
0
(output continues ...)

5.3.2. PROmer

PROmer (PROtein MUMmer) is a close relative to the NUCmer script. It follows the exact same steps as NUCmer and even uses most of the same programs in its pipeline, with one exception - all matching and alignment routines are performed on the six frame amino acid translation of the DNA input sequence. This provides promer with a much higher sensitivity than nucmer because protein sequences tends to diverge much slower than their underlying DNA sequence. Therefore, on the same input sequences, promer may find many conserved regions that nucmer will not, simply because the DNA sequence is not as highly conserved as the amino acid translation.

All of this is performed behind the scenes, as the input is still the raw DNA sequence and output coordinates are still reported in reference to the DNA, so the two programs (nucmer and promer) exhibit little difference in their interfaces and usability. Because of its greatly increased sensitivity, it is usually best to use promer on those sequences that cannot be adequately compared by nucmer, because if run on very similar sequences the promer output can be quite voluminous. This is because promer makes no effort to distinguish between proteins and junk amino acid translations, therefore a single highly conserved gene may have up to six alignments in promer output, one for each of the six amino acid reading frames, when only the correct reading frame would be sufficient. This makes promer ideally suited for highly divergent sequences that show little DNA sequence conservation, as is shown in the following two plots:

nucmer dot plot promer dot plot

These dot plots represent two comparisons of Streptococcus pyogenes (x-axis) and Streptococcus mutans (y-axis), with forward matches colored red and reverse matches colored green. The graph generated with nucmer output is on the left, while the graph generated with promer output is on the right (both run with default parameters). It is clearly visible that promer has aligned the two genomes with a much greater sensitivity, thus demonstrating the effectiveness of comparing two divergent genomes on the amino acid level.

Command line syntax

promer [options] <reference file> <query file>

The reference and query files should both be in multi-FastA format and have no limit on the number of sequences they man contain. However, because promer uses mummer for its maximal exact matching, the memory usage will be dependent on the size of the reference file, so it may be advisable to make the smaller of the input files the reference to assure the program does not exhaust your computer's memory resources. In addition, masking the uninteresting regions of the input with n or x will both speed up promer by reducing the number of possible matches and also cut down on the number of alignments induced by repetitive sequence.

Program options
--mum Use anchor matches that are unique in both the reference and query
--mumreference Use anchor matches that are unique in the reference but not necessarily unique in the query (default behavior)
--maxmatch Use all anchor matches regardless of their uniqueness
-b int
--breaklen
Distance an alignment extension will attempt to extend poor scoring regions before giving up (default 60)
-c int
--mincluster
Minimum cluster length (default 20)
--[no]delta Toggle the creation of the delta file. Setting --nodelta prevents the alignment extension step and only outputs the match clusters (default --delta)
--depend Print the dependency information and exit
-d float
--diagfactor
Maximum diagonal difference factor for clustering, i.e. diagonal difference / match separation (default 0.11)
--[no]extend Toggle the outward extension of alignments from their anchoring clusters. Setting --noextend will prevent alignment extensions but still align the DNA between clustered matches and create the .delta file (default --extend)
-g int
--maxgap
Maximum gap between two adjacent matches in a cluster (default 30)
-h
--help
Print the help information and exit
-l int
--minmatch
Minimum length of an maximal exact match (default 6)
-m int
--masklen
Maximum stop codon bookend masking length (default 8)
-o
--coords
Automatically generate the <prefix>.coords file using the 'show-coords' program with the -r option
--[no]optimize Toggle alignment score optimization. Setting --nooptimize will prevent alignment score optimization and result in sometimes longer, but lower scoring alignments (default --optimize)
-p string
--prefix
Set the output file prefix (default out)
-V
--version
Print the version information and exit
-x type
--matrix
The alignment matrix type, 1 [BLOSUM 45], 2 [BLOSUM 62] or 3 [BLOSUM 80] (default 2)

All values are measured in amino acids unless otherwise noted. Refer to the NUCmer Program options section for more information regarding their shared options. The --masklen value determines the number of amino acids between stop codons that will be automatically masked by promer, e.g. if an amino acid sequence were ...AAA*AAAA*AAA... and the --masklen value were greater than or equal to 4, the sequence would be masked to read ...AAA*XXXX*AAA... for the duration of the script. The --matrix option sets the BLOSUM matrix for scoring mismatches in the amino acid sequence, where options 1 assumes greater diversity between the two sequences and 3 assumes greater similarity between the two sequences.

Output format

Output files follow the same format as described in the NUCmer Output format section.

5.3.3. run-mummer1

run-mummer1 is a legacy script from the original MUMmer1.0 release. It has been updated to utilize the new suffix tree code of version 3.0, however all other programs called from this script are identical to the original MUMmer release back in 1999. Even though it is an outdated program, it still has some advantages over the newer alignment scripts (nucmer, promer, run-mummer3). Like all of the alignment scripts, run-mummer1 is a three step process - matching, clustering and extension. However, unlike the newer alignment scripts, run-mummer1 uses the gaps program for its clustering step. The gaps program does not allow for rearrangements like mgaps, instead if finds the single longest increasing subset of matches across the full length of both sequences. This makes it well suited for SNP and small indel identification between small (< 10 Mbp), very similar sequences with few to no rearrangements.

Command line syntax

run-mummer1 <reference file> <query file> <prefix> [-r]

The reference and query files must both be in FastA format and contain only one sequence. Memory usage will be dependent on the size of the reference sequence, so it may be advisable to make the smaller of the input files the reference to assure the program does not exhaust your computer's memory resources. run-mummer1 uses a simplified scoring function that does not recognize masking characters, so it is not recommended to perform any masking on the input sequences. The <prefix> value will be prefixed to the names of the resulting output files. The -r is optional and tells the script to reverse complement the query input sequence, thus all output coordinates will reference the reverse complement of the query. If the -r option is omitted, all matching will be limited to the forward strand of each sequence; if it is included, all matching will be limited to the forward strand of the reference and the reverse strand of the query.

Program options

There are no available command line options for run-mummer1. Instead, the user must directly edit the sh script to alter the command line values passed to the individual pipeline programs. The only available tweak is changing the minimum match length value for mummer, set with the -l option within the script. Decreasing this value may increase the sensitivity of the script, but may drastically increase the resulting runtime.

Output format

There are four output files generated with each call of run-mummer1, and each of these files is prefixed with the <prefix> value set on the command line. Each of these files will be referred to by its file extension (out, gaps, errorsgaps, align), and are described below.

The "out" file format

The standard output of the mummer program with it's header information stripped, see the mummer output section for more information. Just a simple three column list, noting the position and length of every maximal exact match. Note that for reverse complement matches (produced with the -r option), the query start positions will reference the reverse complement of the query input sequence.

The "gaps" file format

The standard output of the gaps program, see the gaps output section for more information.

The "errorsgaps" file format

An annotated version of the gaps format, with an extra column listing the number of errors counted in each gap. This is perhaps the most useful output file produced by run-mummer1 as it is easy to parse and identify SNPs, which appear as a '1' in the final column. A '-' character in the final column means the alignment was too large to compute. Example slice from an errorsgaps file:


  403382   356512     77    none      1      1       -
  403466   356595     56    none      7      6       4
  403542   356670     81    none     20     19       2
  403626   356756     75    none      3      5       4
The "align" file format

The align file is difficult to parse, but contains some useful visual information. It intersperses the gaps output file with the actual pair-wise alignment of each gap. Each alignment follows the listing of the two involved matches and uses a '^' character to identify the non-identities. If an alignment was too large to process in memory a tag reading "*** Too long ***" will be listed in its place. Example align file:


> /home/aphillip/data/mgen.seq reverse Consistent matches
  170273   729167    158    none      8      8
  170433   729327     34    none      2      2
    Errors = 2
T:  gaaggtctttttgattgtaaag
S:  gaaggtctttaagattgtaaag
              ^^          
  170501   729395    155    none     34     34
    Errors = 4
T:  aagaatgactctagcaggcaatggctggagtttgactgtaccactttgaataag
S:  aagaatgactttagcaggtaatggctagagtttgactgtaccattttgaataag
              ^       ^       ^                ^          
  170659   729553    187    none      3      3
    Errors = 2
T:  tggaaactatcagtctagagtgt
S:  tggaaactattaatctagagtgt
              ^ ^          
  170856   729750    281    none     10     10
    Errors = 2
T:  tagctgtcggagcgatcccttcggtagtga
S:  tagctgtcggggcgatcccctcggtagtga
              ^        ^          
(output continues ...)

Each alignment region is padded with 10bp of the exact match surrounding it on either side.

5.3.4. run-mummer3

run-mummer3 is the simplest pipeline of the latest MUMmer3.0 programs. It runs the same matching and clustering algorithm as nucmer and promer, however it uses a different extension technique and does not perform the important pre- and post-processing steps of NUC/PROmer. Because of its simplistic form, run-mummer3 can only handle a single reference sequence, but like run-mummer1 its error-focused output makes it a handy tool for detecting SNPs and other small errors. The only major difference between run-mummer3 and run-mummer1 is the new version's ability to handle multiple query sequences and its tolerance of large rearrangements. This makes run-mummer3 well suited for error detection between highly similar sequences that may have large rearrangements, inversions etc. Edit the script by adding the -D option to the combineMUMs command line to output a format designed for SNP identification. Still, run-mummer3 provides few advantages of the more user friendly nucmer program, and should be avoided where possible.

Command line syntax

run-mummer3 <reference file> <query file> <prefix>

The reference and query files should both be FastA format. The reference file may only have a single sequence, but there is no limit on the number of sequences the query file may contain. It is very important that the reference file only contain one sequence, because the script will give you no indication something went wrong and there will just be empty output files. run-mummer3 uses a simplified scoring function that does not recognize masking characters, so it is not recommended to perform any masking on the input sequences. The <prefix> value will be prefixed to the names of the resulting output files. Both forward and reverse complement matches will be found by default; to change this behavior or change any parameters, requires requires hand editing the script.

Program options

There are no available command line options for run-mummer3. Instead, the user must directly edit the sh script to alter the command line values passed to the individual pipeline programs. Altering these parameters is suggested for most applications, as the default values may not always produce the best output. Parameter values may be added or changed for mummer, mgaps and combineMUMs. Run these programs with the -help option for a list of available options, or refer to this manual for more information on mummer or mgaps. Note that the -c option cannot be used for mummer in this script, or mgaps will fail to cluster the reverse complement matches.

Output format

Like run-mummer1, run-mummer3 produces four output files prefixed with the value set on the command line. Each of these files will be referred to by its file extension (out, gaps, errorsgaps, align), and are described below.

The "out" file format

Pure, unadulterated mummer output. See the mummer output section for more information. Just a simple three column list, noting the position and length of every maximal exact match. Note that for reverse complement matches, the query start positions will reference the reverse complement of the query input sequence.

The "gaps" file format

The standard output of the mgaps program, see the mgaps output section for more information.

The "errorsgaps" file format

An annotated version of the gaps format, with an extra column listing the number of errors counted in each gap. This is perhaps the most useful output file produced by run-mummer1 as it is easy to parse and identify SNPs, which appear as a '1' in the final column. A '-' character in the final column means the alignment was too large to compute. Example slice from an errorsgaps file:


  403382   356512     77    none      1      1       -
  403466   356595     56    none      7      6       4
  403542   356670     81    none     20     19       2
  403626   356756     75    none      3      5       4
The "align" file format

The align file is difficult to parse, but contains some useful visual information. It intersperses the mgaps output file with the actual pair-wise alignment of each gap. Each alignment follows the listing of the two involved matches and uses a '^' character to identify the non-identities and a '=' character to identify the MUM portion. The gap alignment is also padded with 10bp of the exact match surrounding it on either side. Example align file:


(... output continues)
> ID21
 3944620       24    983    none      -      -
 3945604     1008     22    none      1      1
     Errors = 1
A: agactctttctttggttgatt
B: agactctttccttggttgatt
   ==========^==========
 3945655     1059     26    none     29     29
     Errors = 3
A: cttgcgattgtctttgcatttgtctttgtttctttttcttcatgctgct
B: cttgcgattggctttgcatttggctttgtttctttttcctcatgctgct
   ==========^           ^               ^==========
 3945684     1088     29    none      3      3
     Errors = 2
A: ttacttttttctc-cattatagta
B: ttactttttt-tctcattatagta
   ==========^  ^==========
Region:    3944620 .. 3945743           24 .. 1146             8 / 1124        0.71%
> ID21 Reverse
> ID22
> ID22 Reverse
 5183942        8     31    none      -      -
 5183980       47   4221    none      7      8
     Errors = 3
A: cccagaaaac-accacctccggccagta
B: cccagaaaaccaccactcccggccagta
   ==========^     ^^==========
 5188202     4269    314    none      1      1
     Errors = 1
A: tgcaccagaacgtaataatcc
B: tgcaccagaaagtaataatcc
   ==========^==========
Region:    5183942 .. 5188515         4578 .. 4                4 / 4575        0.09%
(output continues ...)

After each cluster, the align file prints a line beginning with the Region keyword that shows the start and stop of the alignment in the reference and the start and stop of the alignment in the query respectively. The query coordinates in the region line will reference the forward strand of the query, while the lines taken from the gaps file will still reference the reverse strand of the query. The region line also shows and error ratio and the error percentage.

5.4. Utilities

MUMmer includes a few utility programs intended to parse the delta encoded alignment files and output their contents to the user. The majority of these programs will only operate on the delta file output of NUCmer or PROmer, however the generalized visualization tool, mummerplot, will function on a variety of input.

5.4.1. delta-filter

delta-filter is a utility program for the manipulation of the delta encoded alignment files output by the NUCmer and PROmer pipelines. It takes a delta file as input and filters the information based on the various command line switches, outputting only the desired alignments to stdout. Options to filter by alignment length, identity, uniqueness and consistency are provided. Certain combinations of these options can greatly reduce the number of unwanted alignments in the delta file, thus making the output of programs such as show-coords more comprehendible.

Command line syntax

delta-filter [options] <delta file> > <filtered delta file>

The <delta file> may represent either NUCmer of PROmer data. The <filtered delta file> will be the filtered down version of the input. Output will be to stdout. delta-filter run with no options is the identity function.

Program options
-g Global alignment using length*identity weighted LIS (longest increasing subset). For every reference-query pair, leave only the alignments which form the longest mutually consistent set
-h Print the help information and exit
-i float Set the minimum alignment identity [0, 100], (default 0)
-l int Set the minimum alignment length (default 0)
-q Query alignment using length*identity weighted LIS. For each query, leave only the alignments which form the longest consistent set for the query
-r Reference alignment using length*identity weighted LIS. For each reference, leave only the alignments which form the longest consistent set for the reference.
-u float Set the minimum alignment uniqueness, i.e. percent of the alignment matching to unique reference AND query sequence [0, 100], (default 0)
-o float Set the maximum alignment overlap for -r and -q options as a percent of the alignment length [0, 100], (default 75)

The -g option simulates the behavior of MUMmer1 by performing a similar algorithm to determine the longest mutually consistent set of matches, while the -r and -q option only require the match set to be consistent with respect to either the reference or query respectively. The difference being, the -g option does not allow for inversions, translocations, etc. while the -r and -q options do. However, none of these options (-g -r -q) allow for the inclusion of multiple repeat copies. Use -g when aligning two sequences which are globally consistent, use -r for determining the best mapping of a reference to a query (one-to-many), use -q for determining the best mapping of a query to a reference (many-to-one), and use -r and -q in conjunction for a one-to-one mapping of reference to query. The -u option is handy for keeping only those alignments which are anchored in unique sequence. The -o option sets the alignment overlap tolerance for the -r and -q options, i.e. the amount two adjacent alignments included by -r or -q are allowed to overlap.

Output format

Output format is the same as the input format. See the NUCmer Output format section for more details.

5.4.2. mapview

mapview is a utility script for displaying sequence alignments as provided by NUCmer or PROmer. It takes the output from show-coords or mgaps and converts it to a FIG, PDF or PS image file. By default, it produces FIG files which can be viewed with the common system utility xfig or converted to PDF or PS with the fig2dev utility (neither programs are included with MUMmer). mapview is useful for mapping multiple query contigs (e.g. from a draft sequencing project) against an annotated reference sequence. Exons and other features can also be plotted with the NUCmer or PROmer alignments, aiding in exon refinement and analysis. Individual MUMmer hits are plotted according to their percent identity, making regions of high or low similarity easily distinguishable.

Command line syntax

mapview [options] <coords file> [UTR coords] [CDS coords]

The <coords file> must be produced with the show-coords program run with the -r -l options (see show-coords section), or the mgaps program. This coords file may represent either NUCmer or PROmer dataode>-ricult to parse, tered delta file> will be the filtered down version of the inpptiotlysis. Indm942 .. 5188515 0de>mummer protocg alooe, wÙRM²…&ëfault 0)<> &r PROmer, however without2Ô<º­SÙÍØé|@Ýataat)Ar S tgcaccagaaagtlkotillus ri=====2and PROmethoumuch in common with the standa of the ieo twoagtlkotillus r2 .. 5188515 0de>mummer protocg alooe, wÙRM²…&ëfault 0h the -hdividual pio PROmeior a list of available options, or refer to this manual for more information on mummer or mgaps. Note that the -c option cannot be used for mummer in this script, or mgaps will fail to cluster the rewerse complement matches.

Output format

Like run-mummer1, run-mummer3 produces four output files prefixed with the value set on the command line. Each of these files will be referred to by its file extension (out, gaps, errorsar> Snd line. Each o2) aliitt>run-mummer3ion, its output can e>2ed in a varity otetsys with the will faoddivicode> /code> de> is a ut option cannot be use>

Progrvior)
Pro;-8" targefix&gdulterated mum targefix&gdc option de> because proteindeoption de> > for determiningeoption de> > for determiningeoption de> > for deteption de> ions] &an in red, while reverse> option dehe match t